dna

Chemists in Japan report development of the world's first DNA molecule made almost entirely of artificial parts. The finding could lead to improvements in gene therapy, futuristic nano-sized computers, and other high-tech advances:

No S**t

More here: http://events.ccc.de/congress/2007/Fahrplan/events/2329.en.html

As the cost of sequencing a single human genome drops rapidly, with one company predicting a price of $100 per person in five years, soon the only reason not to look at your "personal genome" will be fear of what bad news lies in your genes.

University of California, Berkeley, scientists, however, have found a welcome reason to delve into your genetic heritage: to find the slight genetic flaws that can be fixed with remedies as simple as vitamin or mineral supplements.

A Nature News article describes the initial plans for an ambitious effort to begin mapping the complete human proteome: the set of all human proteins expressed in all of our cells at all points during our development and adult life.

This is a project of vastly greater magnitude and complexity than the sequencing of the human genome. Unlike the genome, which remains essentially static between cell types and over time, the proteome is tremendously dynamic, changing constantly in response to cell-cell signalling and environmental stimuli.

via

For nearly 50 years, the central dogma of biology has been that genetic information is contained within DNA and is passed by rote transcription through RNA to make proteins.

The central dogma is being eroded, and it now appears as if DNA's cousin, the humble intermediary RNA, plays at least an equal role in genetics and the evolution of the species.

via Seed Magazine

GGGGTAGGCGTTCTTGATGGAGGCGTCATGGATGTCATGGTTGAGCTTATGGTC
TCAGTCGTTCTTGCTATGGAAGTAGGCGCTATGTAGGAGGATCTCGAGATGTAG
CTTATGGGCGGGCTTGTACGTGTTCTT

what does that mean then??